Ezbiocloud.net


Keyword Suggestion

Ezbiocloud
Ezbiocloud 16s database
Ezbiocloud database
Ezbiocloud ani



Domain Informations

Ezbiocloud.net lookup results from whois.whois.co.kr server:
  • Domain created: 2010-09-26T04:07:52Z
  • Domain updated: 2022-08-08T07:31:10Z
  • Domain expires: 2027-09-26T04:07:52Z 3 Years, 12 Days left
  • Website age: 13 Years, 353 Days
  • Registrar Domain ID: 1617489246_DOMAIN_NET-VRSN
  • Registrar Url: http://www.whois.co.kr
  • Registrar WHOIS Server: whois.whois.co.kr
  • Registrar Abuse Contact Email: [email protected]
  • Registrar Abuse Contact Phone: +82.15884259
  • Name server:
    • NS1.WHOISDOMAIN.KR
    • NS2.WHOISDOMAIN.KR
    • NS3.WHOISDOMAIN.KR
    • NS4.WHOISDOMAIN.KR

Network
  • inetnum : 13.125.0.0 - 13.125.255.255
  • name : AMAZON-ICN
  • handle : NET-13-125-0-0-1
  • status : Reallocated
  • created : 2016-03-24
  • changed : 2019-08-02
Owner
  • organization : AWS Asia Pacific (Seoul) Region
  • handle : AAPSR
  • address : Array,Seoul,KR
Technical support
  • handle : ANO24-ARIN
  • name : Amazon EC2 Network Operations
  • phone : +1-206-555-0000
  • email : [email protected]
Abuse
  • handle : AEA8-ARIN
  • name : Amazon EC2 Abuse
  • phone : +1-206-555-0000
  • email : [email protected]
Domain Provider Number Of Domains
godaddy.com 286730
namecheap.com 101387
networksolutions.com 69118
tucows.com 52617
publicdomainregistry.com 39120
whois.godaddy.com 32793
enomdomains.com 23825
namesilo.com 21429
domains.google.com 21384
cloudflare.com 20573
gmo.jp 18110
name.com 17601
fastdomain.com 14708
register.com 13495
net.cn 12481
ionos.com 12416
ovh.com 12416
gandi.net 12305
registrar.amazon.com 12111


Host Informations

  • IP address: 13.125.52.17
  • Location: Incheon South Korea
  • Latitude: 37.4562
  • Longitude: 126.7288
  • Timezone: Asia/Seoul

Check all domain's dns records


See Web Sites Hosted on 13.125.52.17

Fetching Web Sites Hosted


Site Inspections


Port Scanner (IP: 13.125.52.17)

 › Ftp: 21
 › Ssh: 22
 › Telnet: 23
 › Smtp: 25
 › Dns: 53
 › Http: 80
 › Pop3: 110
 › Portmapper, rpcbind: 111
 › Microsoft RPC services: 135
 › Netbios: 139
 › Imap: 143
 › Ldap: 389
 › Https: 443
 › SMB directly over IP: 445
 › Msa-outlook: 587
 › IIS, NFS, or listener RFS remote_file_sharing: 1025
 › Lotus notes: 1352
 › Sql server: 1433
 › Point-to-point tunnelling protocol: 1723
 › My sql: 3306
 › Remote desktop: 3389
 › Session Initiation Protocol (SIP): 5060
 › Virtual Network Computer display: 5900
 › X Window server: 6001
 › Webcache: 8080


Spam Check (IP: 13.125.52.17)

 › Dnsbl-1.uceprotect.net:
 › Dnsbl-2.uceprotect.net:
 › Dnsbl-3.uceprotect.net:
 › Dnsbl.dronebl.org:
 › Dnsbl.sorbs.net:
 › Spam.dnsbl.sorbs.net:
 › Bl.spamcop.net:
 › Recent.dnsbl.sorbs.net:
 › All.spamrats.com:
 › B.barracudacentral.org:
 › Bl.blocklist.de:
 › Bl.emailbasura.org:
 › Bl.mailspike.org:
 › Bl.spamcop.net:
 › Cblplus.anti-spam.org.cn:
 › Dnsbl.anticaptcha.net:
 › Ip.v4bl.org:
 › Fnrbl.fast.net:
 › Dnsrbl.swinog.ch:
 › Mail-abuse.blacklist.jippg.org:
 › Singlebl.spamgrouper.com:
 › Spam.abuse.ch:
 › Spamsources.fabel.dk:
 › Virbl.dnsbl.bit.nl:
 › Cbl.abuseat.org:
 › Dnsbl.justspam.org:
 › Zen.spamhaus.org:


Email address with ezbiocloud.net

Found 0 emails of this domain

Recent Searched Sites

Corplex.com (42 seconds ago) / US

Atvn.pl (4 seconds ago) / PL

Camsa.com.bo (14 seconds ago) / DE

Xxx18hot.click (1 seconds ago) / US

Cnfyg.com (9 seconds ago) / US

Hotelstadhouderlijkhof.nl (2 seconds ago) / US

Video.acadpia.online (3 seconds ago) / US

Dunhamlaw.com (27 seconds ago) / US

Safetyalertcenter.com (18 seconds ago) / US

Diamondscheduler.jp (5 seconds ago) / US

Tmastco.com (25 seconds ago) / US

Mp3juice.icu (1 mins ago) / US

Ezbiocloud.net (3 seconds ago) / KR

Cdm.edu.ph (25 seconds ago) / SG

Tvsporedi.si (36 seconds ago) / SI

Bolsosmacoly.com (13 seconds ago) / US

Printyourbrackets.com (16 seconds ago) / US

Louisbhkop.getblogs.net.luckygirl.co.kr (12 seconds ago) / KR

Tendersinfo.com (16 seconds ago) / IN

74maomm.com (7 seconds ago) / US

Websites Listing

We found Websites Listing below when search with ezbiocloud.net on Search Engine

EzBioCloud.net | Search about Bacteria or Archaea

EzBioCloud is a platform for microbiology and infectious disease research. We provide comprehensive resources for bacterial identification, genomics and microbiome. DASHBOARD ; APPS ; TOOLS ; RESOURCES ; HOW TO CITE ; ABOUT ; HELP CENTER; SUPPORT. News and updates; Release note; FAQ; Publication; Contact; LICENSES; [email protected]. My …

Ezbiocloud.net

Confirmation email sent - EzBioCloud.net

* For public domain email users, both institutional and public domain account should be confirmed. Information. OK. Information. OK ... Users affiliated with academic and non-profit institutions are entailed to free use of EzBioCloud's database and bioinformatics applications with conditions. Reproduction or redistribution of EzBioCloud is strictly prohibited by applicable law …

Ezbiocloud.net

Ezbiocloud.net

[email protected]. My information; Log out ; Taxonomy. This complete taxonomic hierarchy of Bacteria and Archaea was manually constructed by the EzBioCloud team using numerous maximum likelihood phylogenetic trees based on 16S sequences. 1 Level 2 Level 3 Level * Root; Bacteria Woese et al. 1990. 10BAV. A3DB. AB177176_p. AB179666_p. AB193897_p. …

Ezbiocloud.net

EzBioCloud.net | Search about Bacteria or Archaea

Check your email to change your password. To reset your password, please click on the link in the email. Information. OK. Information . OK ... Users affiliated with academic and non-profit institutions are entailed to free use of EzBioCloud's database and bioinformatics applications with conditions. Reproduction or redistribution of EzBioCloud is strictly prohibited by applicable law …

Ezbiocloud.net

EzBioCloud Apps

[email protected]. My information; Log out; EzBioCloud Apps. Learn more about these applications . Identification of Prokaryotes. Open. 16S-based ID . Identifying a bacterial isolate using 16S rRNA. Data. Open. Genome-based ID (TrueBac ID) Identifying a bacterial isolate using genome. My data. Microbiome/Metagenomics. Open. 16S-based MTP. Microbiome …

Ezbiocloud.net

User Guide – EzBioCloud Help center

User guide. This user guide explains the basic theory and concepts behind bioinformatics for microbiome and bacterial genomics. You will be provided with scientific backgrounds and how to maximize productivity using the EzBioCloud cloud solution. New users of EzBioCloud will require an account. It is free and you will be given a free-trial with ...

Help.ezbiocloud.net

EzBioCloud.net | Terms of Service

Site shall refer to Company, CJ Bioscience’s family websites including www.ezbiocloud.net, www.truebacid.com or www.chunlab.com. You, User and Users. Throughout these Terms and Conditions, “you”, "User", "Users" or “your” refers to you as the user accessing or using any of the Services, or if you are using the Services on behalf of an entity such as your employer, “you”, …

Ezbiocloud.net

EzBioCloud Help center – EzBioCloud Help center

Genome-based Identification for Improving Reference Databases. Misidentified or incompletely identified bacterial genome sequences appear frequently in public reference databases. These databases can be significantly improved by genome-based identification against an up-to-date, systematically curated. Read More ».

Help.ezbiocloud.net

EzBioCloud Apps – EzBioCloud Help center

2018-09-14  · Email. Send. EzBioCloud offers the following applications for microbial genomics: 16S-based ID. This service was previously found under the “Identify” menu. Input data is a single 16S sequence from Bacteria or Archaea, and the output is a list of search hits of known species or carefully selected phylotypes with pairwise sequence similarities. This service has been …

Help.ezbiocloud.net

EzBioCloud 16S database – EzBioCloud Help center

2017-07-10  · Email. Send. Publications that introduced the EzBioCloud 16S database. Our database has been introduced in the following three publications (The numbers of citations are as of Mar. 17, 2018): Yoon, S. H., Ha, S. M., Kwon, S., Lim, J., Kim, Y., Seo, H. & Chun, J. (2017). Introducing EzBioCloud: a taxonomically united database of 16S rRNA gene sequences and …

Help.ezbiocloud.net

EzBioCloud.net | Forgot Password

Enter your email and we will send a link to reset your password to your email. Send new password. Login. Information. OK. Information . OK ... Users affiliated with academic and non-profit institutions are entailed to free use of EzBioCloud's database and bioinformatics applications with conditions. Reproduction or redistribution of EzBioCloud is strictly prohibited …

Eztaxon-e.ezbiocloud.net

EzBioCloud Genome Database – EzBioCloud Help center

2017-09-07  · Email. Send. The EzBioCloud Genome Database is a part of EzBioCloud.net. It is maintained by ChunLab, Inc. to provide best-curated genome database of Bacteria and Archaea. Data sources for the database are NCBI and other public domain (e.g. JGI). The database has the following features: Taxonomically correct database: all genomes are identified using the …

Help.ezbiocloud.net

News and Updates - EzBioCloud.net

[email protected]. My information; Log out; Support. News and Updates; Release note; FAQ; Publications; Contact; New EzBioCloud Release! We are happy to announce that the new EzBioCloud site will now offer our essential bioinformatics services for microbiology. The services will be available starting on January 7, 2019. Please see the “Apps” tab at the top of the …

Eztaxon-e.ezbiocloud.net

Login - Uniview

We will be performing routine maintenance from 02:00:00 to 04:00:00 on Nov. 12, 2020 (Coordinated Universal Time), and service will be affected during this time.

En.ezcloud.uniview.com

Microbiome – EzBioCloud Help center

Get updates and learn from the best. Email. Send

Help.ezbiocloud.net

ezbiocloud.net - EzBioCloud - Minify Mobi

Check if your website is mobile-friendly. Get list of recommendations on how to improve your website mobile usability and performance scores.

Minify.mobi

EZCloud - Uniview

We will be performing routine maintenance from 02:00:00 to 04:00:00 on Nov. 12, 2020 (Coordinated Universal Time), and service will be affected during this time.

En.ezcloud.uniview.com

EzBioCloud for contamination of Illumina raw files

2018-12-04  · >ns500540:135:hff77afxy:1:11101:6499:1061 1:n:0:attactcg+nggatagg ggcattacttcggggtaggtcttaaataagagcgcaatgttggtataggctcccgttggcactaacgtaatcggt >ns500540:135:hff77afxy ...

Biostars.org

EZOnlineMail Webmail :: Welcome to EZOnlineMail Webmail

EZOnlineMail Webmail Login. Username: Password

Webmail.eznettools.net

What is EzCloud.exe? - FreeFixer

EzCloud.exe removal instructions. The instructions below shows how to remove EzCloud.exe with help from the FreeFixer removal tool. Basically, you install FreeFixer, scan your computer, check the EzCloud.exe file for removal, restart your computer and scan it again to verify that EzCloud.exe has been successfully removed.

Freefixer.com


Domains Expiration Date Updated

Site Provider Expiration Date
hurrybuy.com godaddy.com -2 Years, -89 Days
hay-hay.co whois.godaddy.com 1 Day
rafcoprop.com godaddy.com -1 Years, -313 Days
madresane.com 1api.net -1 Years, -256 Days
perfectingpizza.com godaddy.com 56 Days
specialed.us whois.godaddy.com -1 Years, -291 Days
osaka-pitapa.com gmo.jp -1 Years, -349 Days
twptrailers.com godaddy.com -2 Years, -219 Days
rus24.net danesconames.com -1 Years, -298 Days
ecmeds.net namecheap.com -2 Years, -109 Days

    Browser All

    .com4.3M domains   

    .org1M domains   

    .edu40.9K domains   

    .net617.1K domains   

    .gov15.9K domains   

    .us30.9K domains   

    .ca45.1K domains   

    .de560.1K domains   

    .uk466.2K domains   

    .it35K domains   

    .au46.7K domains   

    .co34.2K domains   

    .biz13.9K domains   

    .info36.4K domains   

    .fr37.6K domains   

    .eu24.7K domains   

    .ru195.7K domains   

    .ph5.6K domains   

    .in54.2K domains   

    .vn18.9K domains   

    .cn40.4K domains   

    .ro19.5K domains   

    .ch11.7K domains   

    .at10.3K domains   

    Browser All